Graphene Oxide Purification-Lateral Flow Test Strips (iGOP-LFTS) for Direct Detection of PCR

Built-in Graphene Oxide Purification-Lateral Move Check Strips (iGOP-LFTS) for Direct Detection of PCR Merchandise with Enhanced Sensitivity and Specificity.

An built-in graphene oxide purification-lateral stream check strip (iGOP-LFTS) was developed for on-strip purifying and visually detecting polymerase chain response (PCR) merchandise with an improved sensitivity in addition to a extra stringent specificity.

PCR merchandise amplified with a pair of biotin- and digoxin-labeled primers have been instantly pipetted onto GO pads, on which graphene oxide selectively adsorbed residual primers and primer-dimers with assistance from a working buffer containing MgCl2 and Tween 20. By stacking up three GO pads to extend the floor space for adsorption, 83.4% of double-stranded DNA with a size of 30 bp and 98.6% of 20-nt primers could possibly be faraway from a 10-μL DNA combination.

Since no primers interfered with detection, the rise of the pattern loading quantity from 5 to 20 μL may enhance the signal-to-noise ratio of the check line 1.6 fold utilizing the iGOP-LFTS whereas no adjustments have been noticed utilizing the standard LFTS.

The restrict of detection of the iGOP-LFTS was decided to be 30 copies of bacteriophage λ-DNA with bare eyes and this restrict could possibly be additional decreased to three copies by loading 20 μL of the pattern, which corresponded to a 1000-fold enchancment in contrast to that of the LFTS detected by bare eyes. When the ImageJ evaluation was employed, a 100-fold lower of the detection restrict may be obtained.

As well as, because of the elimination of the primer-dimers, the dim check line noticed within the unfavourable management of the LFTS was eradicated utilizing the iGOP-LFTS. A mock scientific specimen spiked with faulty HIV-1 (human immunodeficiency virus) viruses was efficiently analyzed utilizing a two-step reverse transcription-PCR with 30 amplification cycles adopted by the iGOP-LFTS detection. These important enhancements have been achieved with out introducing any further hands-on operations and instrumentations.

DHPLC Elution Patterns of VDR PCR Merchandise Can Predict Prostate Most cancers Susceptibility in African American Males.

Denaturing high-performance liquid chromatography (DHPLC) is a way that’s used to detect mutations. The intention of the current examine was to find out whether or not DHPLC elution patterns of vitamin D receptor (VDR) gene PCR merchandise can function indicators of susceptibility to prostate most cancers (PCa) threat.

DNA samples of PCa circumstances and controls have been screened for mutations and/or polymorphisms in coding exons of VDR gene utilizing DHPLC evaluation. Logistic regression, phi-coefficient (ϕ), and Backward Wald fashions have been used to research the information.

Comparable elution patterns of exons 1, 6, 7 and 9 together with greater prevalence of heteroduplex DNA have been noticed in PCa samples than in controls. Exons Four and eight had extremely important protecting results (p<0.05). Whereas, exons 5, 7, and 9 have been completely positively correlated with PCa threat (ϕ=1), thus presenting candidate exons considerably related to susceptibility to PCa.

DHPLC elution patterns of the chosen exons could possibly be helpful to foretell susceptibility to develop PCa.

genpcr

dsGreen for Real-Time PCR, 100×, 50 mL
91010	lumiprobe	50 mL	EUR 3169

dsGreen for Real-Time PCR, 100×, 10 mL
81010	lumiprobe	10 mL	EUR 869

dsGreen for Real-Time PCR, 100×, 5 mL
71010	lumiprobe	5 mL	EUR 625

dsGreen for Real-Time PCR, 100×, 1.5 mL
51010	lumiprobe	1.5 mL	EUR 331

dsGreen for Real-Time PCR, 100×, 1 mL
41010	lumiprobe	1 mL	EUR 249

dsGreen for Real-Time PCR, 100×, 100 uL
11010	lumiprobe	100 uL	EUR 59

dsGreen for Real-Time PCR, 100×, 2 mL
61010	lumiprobe	2 mL	EUR 363

Green Dye One Step qRT-PCR Master Mix For Quantitative Real Time PCR With ROX Dye
MB1004-100Reactions	BosterBio	100 Reactions	EUR 327

PMA Real-Time PCR Bacterial Viability Kit - Salmonella enterica (invA)
31033	Biotium	1kit	EUR 428
Description: Minimum order quantity: 1 unit of 1kit

PMA Real-Time PCR Bacterial Viability Kit - Mycobacterium tuberculosis (groEL2)
31034	Biotium	1kit	EUR 399
Description: Minimum order quantity: 1 unit of 1kit

PMA Real-Time PCR Bacterial Viability Kit - Staphylococcus aureus (nuc)
31035	Biotium	1kit	EUR 399
Description: Minimum order quantity: 1 unit of 1kit

PMA Real-Time PCR Bacterial Viability Kit - Staphylococcus aureus (mecA)
31036	Biotium	1kit	EUR 399
Description: Minimum order quantity: 1 unit of 1kit

PMA Real-Time PCR Bacterial Viability Kit - E. coli (uidA)
31050	Biotium	1kit	EUR 428
Description: Minimum order quantity: 1 unit of 1kit

PMA Real-Time PCR Bacterial Viability Kit - Listeria monocytogenes (hly)
31051	Biotium	1kit	EUR 399
Description: Minimum order quantity: 1 unit of 1kit

PMA Real-Time PCR Bacterial Viability Kit - Legionella pneumophila (mip)
31053	Biotium	1kit	EUR 428
Description: Minimum order quantity: 1 unit of 1kit

PMA Real-Time PCR Bacterial Viability Kit - Salmonella enterica (invA) PMAxx
31033-X	Biotium	1kit	EUR 428
Description: Minimum order quantity: 1 unit of 1kit

PMA Real-Time PCR Bacterial Viability Kit - E. coli (uidA) PMAxx
31050-X	Biotium	1kit	EUR 428
Description: Minimum order quantity: 1 unit of 1kit

PMA Real-Time PCR Bacterial Viability Kit - Listeria monocytogenes (hly) PMAxx
31051-X	Biotium	1kit	EUR 428
Description: Minimum order quantity: 1 unit of 1kit

Novel Coronavirus COVID-19 (2019-nCoV) Real Time RT-PCR Kit
RR-0478-02	Liferiver	25 tests/kit	EUR 991
For use with PE5700, MJ-Opticon & other single color systems, ABI7000, ABI7300, ABI7500, ABI7900, ABI StepOne, StepOne plus, MJ-Opticon2, MJ-chromo4, MX3000P, MX3005P, Smart Cycler II, Rotor-Gene 6000, LightCycler 480, CFX 96, Life 96, Slan 96, iCycl Show more
Description: Novel Coronavirus (2019-nCoV) Real Time RT-PCR Kit is used for the qualitative detection of a novel coronavirus, which was identified in 2019 at Wuhan City, Hubei Province, China, in upper respiratory tract specimens (nasopharyngeal extracts, deep cough sputum, etc.) and lower respiratory tract specimens (alveoli irrigation fluid, etc.) by real time PCR systems.

hsa-mir-521 Real-Time RT-PCR Detection and U6 Calibration Kit
20-abx097601	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

PMA Real-Time PCR Bacterial Viability Kit - E. coli O157:H7 (Z3276)
31037	Biotium	1kit	EUR 428
Description: Minimum order quantity: 1 unit of 1kit

Human Real-time PCR DNA Quantitation after QPCR DNA Damage Analysis Kit
DD2H	Detroit R&D	1 Kit	EUR 430

Mouse Real-time PCR DNA Quantitation after QPCR DNA Damage Analysis Kit
DD2M	Detroit R&D	1 Kit	EUR 430

Rat Real-time PCR DNA Quantitation after QPCR DNA Damage Analysis Kit
DD2R	Detroit R&D	1 Kit	EUR 430

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Human Lung Cancer PCR Primer Library
HLUCPL-I	Real Time Primers	1 set	EUR 548

Human Schwann Cell PCR Primer Library
HSCH-I	Real Time Primers	1 set	EUR 548

qPCR plate-foil universal (for Real-time PCR, Light Cycler 480)
A26979	GeneOn	1x100 pcs	EUR 186

Eztime Real - time PCRPremix 2x,Taqman
FYT105-100P	Yeastern Biotech	100 Preps 1.25 ml	Ask for price

PMA Real-Time PCR Bacterial Viability Kit - E. coli O157:H7 (Z3276) PMAxx
31037-X	Biotium	1kit	EUR 428
Description: Minimum order quantity: 1 unit of 1kit

Eztime Real - time PCRPremix 2x,SYBR Green
FYT103-100P	Yeastern Biotech	100 Preps 1.25 ml	Ask for price

Eztime Real - time PCRPremix 2x,SYBR Green
FYT103-400P	Yeastern Biotech	400 Preps 1.25 ml x 4	Ask for price

Eztime Real - time PCRPremix 2x,SYBRGreen , ROX
FYT104-100P	Yeastern Biotech	100 Preps 1.25 ml	Ask for price

Eztime Real - time PCRPremix 2x,SYBRGreen , ROX
FYT104-400P	Yeastern Biotech	400 Preps 1.25 ml x 4	Ask for price

Eztime Real - time PCRPremix 2x,Taqman, ROX
FYT105-400P	Yeastern Biotech	400 Preps 1.25 ml x 4	Ask for price

Eztime Real - time PCRPremix 2x,Taqman, ROX
FYT106-100P	Yeastern Biotech	100 Preps 1.25 ml	Ask for price

0,1ML THIN WALL TUBES 8 PER STRIP. CLEAR & REAL TIME STRIP CAPS
PCR-0108-LP-RT-C	CORNING	125/pk	EUR 709
Description: PCR Plates & Tubes; PCR Strip Tubes and Strip Caps - Axygen

0,1ML THIN WALL TUBES 8 PER STRIP. WHITE & REAL TIME STRIP CAPS
PCR-0108-LP-RT-W	CORNING	125/pk	EUR 770
Description: PCR Plates & Tubes; PCR Strip Tubes and Strip Caps - Axygen

hsa-mir-34a Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097657	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-34b Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097659	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-92a Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097661	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-92b Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097662	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-93 Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097663	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-95 Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097664	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-96 Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097665	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-98 Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097666	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-99a Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097667	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-99b Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097669	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-100 Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097671	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-101 Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097673	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-103 Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097675	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-105 Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097676	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-106a Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097677	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-106b Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097678	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-107 Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097679	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-124 Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097680	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-125a Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097681	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-127 Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097686	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-129 Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097689	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-130a Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097690	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-130b Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097691	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-132 Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097692	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-133a Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097693	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-133b Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097694	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-134 Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097695	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-135b Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097696	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-137 Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097699	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-138 Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097700	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-139 Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097701	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-140 Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097702	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-141 Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097703	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-143 Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097706	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

hsa-mir-145 Real-Time RT-PCR Detection and cel-mir-39-3p Calibration Kit
20-abx097708	Abbexa	EUR 732.00 EUR 1038.00 EUR 523.00	100 rxns 200 rxns 50 rxns
Shipped within 3 weeks.

Quantitative real-time PCR method for the identification of E. coli residual DNA in streptokinase recombinant product.

Recombinant streptokinase is a biopharmaceutical which is normally produced in E. coli. Residual DNA as a contamination and threat issue might stay within the product. It’s mandatory to manage the manufacturing process to exclude any potential contamination.

The intention of the current examine was to develop a extremely particular and delicate quantitative real-time PCR-based technique to find out the quantity of E. coli DNA in recombinant streptokinase. A particular primers and a probe was designed to detect all strains of E. coli.

To find out the specificity, along with utilizing NCBI BLASTn, 28 samples together with human, bacterial, and viral genomes have been used. The outcomes confirmed that the assay detects no genomic DNA however E. coli’s and the specificity was decided to be 100%. To find out the sensitivity and restrict of detection of the assay, a 10-fold serial dilution (101 to 107 copies/µL) was examined in triplicate.

The sensitivity of the check was decided to be 101 copies/µL or 35 fg/µL. Inter-assay and intra-assay have been decided to be 0.86 and 1.69%, respectively. Based mostly on the outcomes, this assay can be utilized as an correct technique to guage the contamination of recombinant streptokinase in E. coli.

Human Relaxin/Insulin Like Family Peptide Receptor 3 (RXFP3) ELISA Kit
RDR-RXFP3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

RXFP3 antibody
70R-32575	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal RXFP3 antibody

RXFP3 antibody
70R-9809	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal RXFP3 antibody

RXFP3 Antibody
ABD5149	Lifescience Market	100 ug	EUR 438

RXFP3 Antibody
37299-100ul	SAB	100ul	EUR 252

RXFP3 Antibody
DF5149	Affbiotech	200ul	EUR 304
Description: RXFP3 Antibody detects endogenous levels of total RXFP3.

RXFP3 Antibody
1-CSB-PA886335	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RXFP3. Recognizes RXFP3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

RXFP3 Antibody
1-CSB-PA873646DSR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RXFP3. Recognizes RXFP3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RXFP3 Antibody
1-CSB-PA873646DSR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RXFP3. Recognizes RXFP3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RXFP3 Antibody
1-CSB-PA580068	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RXFP3. Recognizes RXFP3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

RXFP3 Antibody
1-CSB-PA020280	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RXFP3. Recognizes RXFP3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

RXFP3 Conjugated Antibody
C37299	SAB	100ul	EUR 397

Anti-RXFP3 antibody
STJ112341	St John's Laboratory	100 µl	EUR 277

RXFP3 siRNA
20-abx932318	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RXFP3 siRNA
20-abx932319	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Anti-RXFP3/Salpr Antibody
A06438	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal RXFP3/Salpr Antibody. Validated in WB and tested in Human, Mouse, Rat.

Human RXFP3 shRNA Plasmid
20-abx959666	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RXFP3 Recombinant Protein (Human)
RP043069	ABM	100 ug	Ask for price

RXFP3 Rabbit pAb
A10303-100ul	Abclonal	100 ul	EUR 308

RXFP3 Rabbit pAb
A10303-200ul	Abclonal	200 ul	EUR 459

RXFP3 Rabbit pAb
A10303-20ul	Abclonal	20 ul	EUR 183

RXFP3 Rabbit pAb
A10303-50ul	Abclonal	50 ul	EUR 223

RXFP3 Blocking Peptide
33R-2547	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RXFP3 antibody, catalog no. 70R-9809

RXFP3 cloning plasmid
CSB-CL873646HU-10ug	Cusabio	10ug	EUR 504
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1410 Sequence: ATGCAGATGGCCGATGCAGCCACGATAGCCACCATGAATAAGGCAGCAGGCGGGGACAAGCTAGCAGAACTCTTCAGTCTGGTCCCGGACCTTCTGGAGGCGGCCAACACGAGTGGTAACGCGTCGCTGCAGCTTCCGGACTTGTGGTGGGAGCTGGGGCTGGAGTTGCCGGACG Show more
Description: A cloning plasmid for the RXFP3 gene.

RXFP3 Blocking Peptide
DF5149-BP	Affbiotech	1mg	EUR 195

Polyclonal RXFP3 Antibody (C-term)
AMR09789G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RXFP3 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal RXFP3 Antibody (C-Terminus)
AMR09790G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RXFP3 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal RXFP3 Antibody (Cytoplasmic Domain)
AMR09791G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RXFP3 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

RXFP3 ORF Vector (Human) (pORF)
ORF014357	ABM	1.0 ug DNA	EUR 354

RXFP3 ELISA Kit (Human) (OKCD08553)
OKCD08553	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: RXFP3 is the receptor for RNL3/relaxin-3. Binding of the ligand inhibit cAMP accumulation.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.064ng/mL

RXFP3 ELISA Kit (Human) (OKDD00515)
OKDD00515	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: Receptor for RNL3/relaxin-3. Binding of the ligand inhibit cAMP accumulation.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.057 ng/mL

Mouse RXFP3 shRNA Plasmid
20-abx982381	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RXFP3 Recombinant Protein (Rat)
RP227318	ABM	100 ug	Ask for price

RXFP3 Recombinant Protein (Mouse)
RP169739	ABM	100 ug	Ask for price

RXFP3 sgRNA CRISPR Lentivector set (Human)
K2080301	ABM	3 x 1.0 ug	EUR 339

Rxfp3 ORF Vector (Mouse) (pORF)
ORF056581	ABM	1.0 ug DNA	EUR 506

Rxfp3 ORF Vector (Rat) (pORF)
ORF075774	ABM	1.0 ug DNA	EUR 506

RXFP3 sgRNA CRISPR Lentivector (Human) (Target 1)
K2080302	ABM	1.0 ug DNA	EUR 154

RXFP3 sgRNA CRISPR Lentivector (Human) (Target 2)
K2080303	ABM	1.0 ug DNA	EUR 154

RXFP3 sgRNA CRISPR Lentivector (Human) (Target 3)
K2080304	ABM	1.0 ug DNA	EUR 154

RXFP3 Protein Vector (Human) (pPB-C-His)
PV057425	ABM	500 ng	EUR 481

RXFP3 Protein Vector (Human) (pPB-N-His)
PV057426	ABM	500 ng	EUR 481

RXFP3 Protein Vector (Human) (pPM-C-HA)
PV057427	ABM	500 ng	EUR 481

RXFP3 Protein Vector (Human) (pPM-C-His)
PV057428	ABM	500 ng	EUR 481

Human Relaxin- 3 receptor 1, RXFP3 ELISA KIT
ELI-22043h	Lifescience Market	96 Tests	EUR 824

Rxfp3 sgRNA CRISPR Lentivector set (Rat)
K6127201	ABM	3 x 1.0 ug	EUR 339

Rxfp3 sgRNA CRISPR Lentivector set (Mouse)
K3211901	ABM	3 x 1.0 ug	EUR 339

Relaxin/Insulin Like Family Peptide Receptor 3 (RXFP3) Antibody
20-abx126504	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Relaxin/Insulin Like Family Peptide Receptor 3 (RXFP3) Antibody
20-abx119157	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Relaxin/Insulin Like Family Peptide Receptor 3 (RXFP3) Antibody
abx030791-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Relaxin/Insulin Like Family Peptide Receptor 3 (RXFP3) Antibody
abx030791-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Relaxin/Insulin Like Family Peptide Receptor 3 (RXFP3) Antibody
20-abx174369	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Relaxin/Insulin Like Family Peptide Receptor 3 (RXFP3) Antibody
20-abx178245	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Relaxin/Insulin Like Family Peptide Receptor 3 (RXFP3) Antibody
20-abx321215	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Relaxin/Insulin Like Family Peptide Receptor 3 (RXFP3) Antibody
20-abx322026	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Relaxin/Insulin Like Family Peptide Receptor 3 (RXFP3) Antibody
20-abx327281	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Relaxin/Insulin Like Family Peptide Receptor 3 (RXFP3) Antibody
20-abx211855	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Relaxin/Insulin Like Family Peptide Receptor 3 (RXFP3) Antibody
20-abx212781	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

ELISA kit for Human Relaxin-3 receptor 1 (RXFP3)
KTE60775-48T	Abbkine	48T	EUR 332
The deduced 469-amino acid protein has the characteristic 7-transmembrane domain structure of a G protein-coupled receptor, as well as 2 putative N-glycosylation sites in its N-terminal domain. SALPR shares highest sequence similarity with somatostat Show more
Description: Quantitative sandwich ELISA for measuring Human Relaxin-3 receptor 1 (RXFP3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Relaxin-3 receptor 1 (RXFP3)
KTE60775-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
The deduced 469-amino acid protein has the characteristic 7-transmembrane domain structure of a G protein-coupled receptor, as well as 2 putative N-glycosylation sites in its N-terminal domain. SALPR shares highest sequence similarity with somatostat Show more
Description: Quantitative sandwich ELISA for measuring Human Relaxin-3 receptor 1 (RXFP3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Relaxin-3 receptor 1 (RXFP3)
KTE60775-96T	Abbkine	96T	EUR 539
The deduced 469-amino acid protein has the characteristic 7-transmembrane domain structure of a G protein-coupled receptor, as well as 2 putative N-glycosylation sites in its N-terminal domain. SALPR shares highest sequence similarity with somatostat Show more
Description: Quantitative sandwich ELISA for measuring Human Relaxin-3 receptor 1 (RXFP3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Rxfp3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6127202	ABM	1.0 ug DNA	EUR 154

Rxfp3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6127203	ABM	1.0 ug DNA	EUR 154

Rxfp3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6127204	ABM	1.0 ug DNA	EUR 154

Rxfp3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3211902	ABM	1.0 ug DNA	EUR 154

Rxfp3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3211903	ABM	1.0 ug DNA	EUR 154

Rxfp3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3211904	ABM	1.0 ug DNA	EUR 154

RXFP3 Protein Vector (Rat) (pPB-C-His)
PV303094	ABM	500 ng	EUR 603

RXFP3 Protein Vector (Rat) (pPB-N-His)
PV303095	ABM	500 ng	EUR 603

RXFP3 Protein Vector (Rat) (pPM-C-HA)
PV303096	ABM	500 ng	EUR 603

RXFP3 Protein Vector (Rat) (pPM-C-His)
PV303097	ABM	500 ng	EUR 603

RXFP3 Protein Vector (Mouse) (pPB-C-His)
PV226322	ABM	500 ng	EUR 603

RXFP3 Protein Vector (Mouse) (pPB-N-His)
PV226323	ABM	500 ng	EUR 603

RXFP3 Protein Vector (Mouse) (pPM-C-HA)
PV226324	ABM	500 ng	EUR 603

RXFP3 Protein Vector (Mouse) (pPM-C-His)
PV226325	ABM	500 ng	EUR 603

Rxfp3 3'UTR GFP Stable Cell Line
TU168275	ABM	1.0 ml	Ask for price

RXFP3 3'UTR Luciferase Stable Cell Line
TU022499	ABM	1.0 ml	EUR 1394

Rxfp3 3'UTR Luciferase Stable Cell Line
TU118275	ABM	1.0 ml	Ask for price

RXFP3 3'UTR GFP Stable Cell Line
TU072499	ABM	1.0 ml	EUR 1394

Rxfp3 3'UTR Luciferase Stable Cell Line
TU219859	ABM	1.0 ml	Ask for price

Rxfp3 3'UTR GFP Stable Cell Line
TU269859	ABM	1.0 ml	Ask for price